2016-08-09 13:59 #0 av: Silent_Hill

Varför ser barn ut som sina föräldrar? Varför brås syskon på varandra? Detta beror på att vi ärver egenskaper från våra föräldrar.

Ärftlighet

Våra gener är grunden som definierar våra egenskaper. Vi har alla tusentals olika gener som är gjorda av vårt DNA och som vistas i våra kromosomer. 

Människor har två uppsättningar av kromosomer där det finns 23 st i varje uppsättning vilket gör att vi har totalt 46 kromosomer. 

När ett barn blir till får denna en uppsättning kromosomer från båda föräldrarna. Barnet kan alltså ärva kromosomer från de två uppsättningar från sin mamma och pappa. Den enda regeln är att barnet ska få exakt en av varje kromosom.

Eftersom föräldrarna bidrar med kromosomer slumpmässigt till varje nytt barn, ärver varje barn en unik uppsättning av kromosomer. Detta leder till att varje barn kommer att ha en unik kombination av egenskaper. Vissa kommer från mamman och vissa från pappan. Medan vissa kommer att vara helt unika vilket är produkten av den nya kombinationen av kromosomer. 

Egenskaper

En egenskap är något som kännetecknar en person. Vi har alla en unik kombination av egenskaper som gör oss unika. 

Egenskaper går vidare från generation till generation som vi ärver av våra föräldrar. 

Det finns tre typer av egenskaper:

  • ⦁ Fysiska egenskaper såsom hårfärg, ögonfärg och längd
  • ⦁ Beteendemässiga egenskaper 
  • ⦁ Medicinska anlag. En ökad risk att få en viss sjukdom är också en egenskap vi ärver från våra föräldrar. 

Men samtidigt som vi kan ärva en egenskap så kan vi också med våran miljö ändra en egenskap. Ett exempel är att vi föds med en viss hårfärg men exponeras håret av mycket solljus så kan vi lätt förändra hårfärgen.

Men hur bestäms det vilken egenskap vi får?

Prova att böja din tumme. Vissa har en förmåga att böja sin tumme i en 45 graders vinkel bakåt vilket kallas för "liftarens tumme". Medan vissa har en helt rak tumme som inte går att böja. Vilken typ har du?

Denna genetiska information för varje form kallas för en allel. 

Vi beskriver den raka tummen med ett "H" och den böjda med "h"

Vi har alla två varianter för denna egenskap vilket leder till att vi kommer ha nån av dessa kombinationer:

H+H

H+h

h+h

Dom som har H+H kommer alltså att ha raka tummar och h+h böjda tummar. Men hur blir det då med dom som har H+h? Dom kommer att ha raka tummar eftersom H är den dominanta genen och h den recessiva.

När vi får barn ärver han eller hon en av de två varianterna från varsin förälder och varje nytt barn kan få olika kombinationer. 

Detta är dock en enkel variant av egenskap som vi kan ärva. Det finns mer komplexa egenskaper som inte kan spåras lika enkelt. 

DNA

Vi har många celler i kroppen som har olika uppgifter beroende på vart i kroppen de är. Men hur kan cellerna veta vad dom ska göra? Inuti varje cell finns det särskilda instruktioner som är nödvändiga för att en cell ska kunna leva och växa. Dessa instruktioner talar om vad cellens uppgift är.

Men hur ser dessa instruktioner ut?

Intruktionerna är i form av en molekyl som kallas DNA. DNA är programmerade med en detaljerad plan likt en ritning som är till för att kunna bilda olika delar av cellen. 

Men hur kan en molekyl bevara information?

DNA molekylen kallas för dubbelspiral och ser ut som en vriden stege. Stegens pinnar är skapade med fyra bokstäver från det genetiska alfabetet: A,C,T och G. Dessa bokstäver förenas enligt en särskild regel: A paras alltid ihop med T och C paras ihop med G. 

Men hur kan fyra bokstäver tala om för cellen vad den ska göra?

  • ⦁ DNA-strängen är gjord av bokstäver: ATGCTCGAATAAATGTCAATTTGA
  • ⦁ Dessa bokstäver gör ord: ATG CTG GAA TAA ATG TCA ATT TGA
  • ⦁ Och dessa ord bygger meningar: <ATG CTG GAA TAA >< ATG TCA ATT TGA>

Dessa meningar kallas för gener. Generna talar om för cellen att göra andra molekyler som kallas för proteiner. Dessa proteiner gör så att cellen kan utföra speciella uppgifter som att t.ex arbeta med andra celler som gör att hörseln blir möjlig. 

Gener

Så alltså: gener är som en manual för vår kropp och håller i regin så att proteinerna kan skapas. Gener är gjorda av DNA. En "stegpinne" i DNA spiralen innehåller många gener. Alla dessa gener är nödvändiga för att ge instruktioner så att alla delar i vår kropp kan fungera. 

Som ett exempel: vårt blod innehåller röda blodkroppar som transporterar syre genom hela kroppen. Cellerna använder sig av ett protein som kallas hemoglobin som fångar och transporterar syret. 

Av alla 25.000 gener så är det bara några som ansvarar för skapandet av hemoglobin proteiner. De resterande generna har andra uppgifter som skapas i vår kropp. 

Så om vår hemoglobin gen är normal så fungerar allt korrekt. Men om instruktionerna i den genen är förändrad eller muterad ändras resultatet. En sådan mutation kan t.ex orsaka sjukdomen sicklecellanemi. 

Så gener innehåller instruktioner som skapar proteiner som är delaktiga i olika saker. Hemoglobin var ett exempel medan andra proteiner som t.ex enzymer som bildar pigment i ögat och keratiner som är ansvariga för hår och nagelväxt

Proteiner

Så proteiner är alltså maskineriet som gör att allt levande fungerar. Det finns omkring 100 biljoner celler och varje cell är ansvariga för en specifik uppgift. Varje cell innehåller tusentals proteiner som fungerar som en liten maskin och driver cellen. 

Vad händer i kroppen när vi får ont?

Nervsystemet är ansvarig för att vi känner smärta. Den sänder ut signaler från smärtområdet till vår hjärna på ett ögonblick. 

Så vad är proteinernas roll i smärtan?

Vårat nervsystem fungerar ungefär som en telefonlinje där flera celler är placerade i en linje som sänder smärtsignaler. Den mottagande änden av varje cell i raden har speciella proteiner på dess yta som kallas receptorer.

Receptorer är en protein som är ansvariga för att plocka upp signalen och sprida den vidare till nästa cell. 

Till skillnad från andra celler så är dessa inte runda utan istället har dom som grenar som hjälper dom att kommunicera med nästa cell som är i linjen. 

Speciella proteiner som kallas för "strukturella proteiner" hjälper cellerna att sträcka ut sina grenar och hålla dom på plats. 

Strukturella proteiner ser ut som tegelstenar och är staplade på varandra för att ge cellerna ett stöd och ger dess form. 

Dessa proteiner är bara två av tusentals som hjälper cellerna att göra sitt jobb. Varje cell i din kropp är lika komplex! 

Proteiner är riktigt små och till och med ett elektronmikroskop är det svårt och se dom. Forskarna brukar använda sig av ett datorprogram där dom gör modeller av proteiner för att se dess struktur och funktion. 

Cellerna använder sig av informationen som är kodade i deras gener vilket funkar lite som ett protein bibliotek. Varje gen är kodade med information om hur man skapar proteinerna. 

När en cell behöver göra en särskild protein läser cellkärnan av informationen från genen för att producera ett meddelande i molekylen RNA, som är väldigt lik DNA. RNA förflyttar sig sedan från cellkärnan till cytoplasman inne i cellen. Väl där så läser enzymen "ribosom" meddelandet och producerar den protein som anges i genen. När proteinet är skapat förflyttar den sig till den delen av cellen där den behövs och börjar jobba. 

Kromosomer

Varje cell i vår kropp innehåller mycket DNA. Om du tar DNA från en enda cell och sträckte ut den så skulle den bli hela tre meter lång. 

Men hur får allt DNA plats i en cell? Det är just denna packningen som kallas för kromosomer. 

Att "packetera" DNA till en kromosom sker i många olika steg som börjar med att DNA:t lindar in sig i några proteiner. Dessa proteiner packeteras tätt intill varandra tills dom formar en kromosom. Kromosomer är  effektiva förvaringsenheter av DNA.

Varje cell hos människor har 46 kromosomer som är uppdelade i 23 kromosompar (23+23=46)

Så vad kan vi lära oss av att kolla på våra kromosomer?

På bilden ser vi kromosomer som ligger i par. I varje par har vi fått en kromosom från mamma och en från pappa. Det finns två typer av kromosomer som fastställer vilket kön vi får, X och Y. Kromosomerna på bilden kan vi se är från en man då bara en man har en kromosom från varje medan en kvinna har XX. 

Källa: http://learn.genetics.utah.edu/